JASPAR Collection CNE

Total 233 profiles

Display profiles
ID Name Consensus Species Sequence logo
CN0121.1 LM121 AGCTGCAAATTGCATTC Homo sapiens
CN0122.1 LM122 GMAGCTTTTAATGA Homo sapiens
CN0123.1 LM123 WGCTGTCAKTTKTMATK Homo sapiens
CN0124.1 LM124 YTGCCAAATGGAAAW Homo sapiens
CN0125.1 LM125 GCTAATTRCAAATSA Homo sapiens
CN0126.1 LM126 YTGCTCTAATTGCA Homo sapiens
CN0127.1 LM127 TTTTGACAGCTCAG Homo sapiens
CN0128.1 LM128 TGCCAAGTTTCAGCCTGGAG Homo sapiens
CN0129.1 LM129 WGMCAGATGRTMTKKNW Homo sapiens
CN0130.1 LM130 TCTGATTGGCTGKCR Homo sapiens
Showing 10 profiles of page 13 from 24 pages

Analyze selected profiles

Please select matrix profiles on the left side to add to your cart or perform the following analysis.


You have 0 profile(s) in your cart. You can add profiles to the cart to download or perform analysis.

Input a (FASTA-formatted) sequence to scan with selected matrix models.

(3000 nucleotides left)

Relative profile score threshold %

Cluster selected models using STAMP tool.




You can use the Newick tree from results to visualize on PhyloTree

Create random matrix models based on selected models.


Create models with permuted columns from selected models.


Download the PFMs of the model(s) selected in four different formats.